UKYOU: AFFAIRS OF THE HEART A saga of six books BOOK II Boy Trouble or Blood is Thicker Than Gender Epilogue Morning. She leaned against the railing of her balcony and looked over the city, her loose white nightgown allowing the breeze to play along her skin like icy fingers. Smiling, she drank in the sunshine, breathing in the sharp fragrance of the crisp November air. Finally she entered the apartment, closing the door to prevent the heat from escaping. He was gone, off to make the final preparations for their departure. The decision to leave had been mutual, a need to leave this place behind forever, along with the memories it held. Some memories, that still walked. As she sat and began to comb her hair, her mind drifted back to last night...that last and first night. (1) She shook for a moment with the memory of it, the memory of his touch. A touch she had wanted for most of her life, even if she didn't realize the sorrow which would come along with it. Somehow, though, it still made her happy. Maybe it was true that you could look back on the darker times of your life and laugh. If so, she wasn't ready to laugh...not yet. Maybe, though, she was ready to stop crying. (2) The pain came again; sharp and sudden and unbidden. The pain of long nights spent crying herself to sleep. The pain of even longer days caught up in a fantasy that when shattered had nearly destroyed her. The pain of longing, and misplaced love. It still took an effort to push away the pain, but it was much simpler now. She breathed a sigh of relief and looked at herself in the mirror. By some freak coincidence, from this angle, in this light, with her hair tied back just so, you could have easily mistaken her reflection for that of a boy's. As she stared at this image, an old memory, dredged up from her darker ones resurfaced. It was mocking, accusing, and she felt the pain it had conjured as if it were happening now, and not that fateful summer. A summer when a visitor had come to Nerima... ******** 1) No, I _won't_ give lurid details. Begone, hentai! 2) Was that a beautifully written piece of prose or what? Talent like that should be encouraged, ne? E-mail me at chmcneil@upei.ca and I'll tell you where to send your donations. Cash, checks and expensive gifts all accepted. ******** Part 2 Nerima had returned to normal (1) in the two days since Tsu- basa's challenge. After the revelation of Tsubasa's actual skill, the group had descended on him like a pack of ravenous wolves. Ukyou was exceedingly pleased by the announcement from the doctor that it would be at least a couple of days before the transvestite was even conscious, and several weeks before he could be released. Of course, Ranma wasn't as thrilled by the aftermath as she was. Not only was he a laughingstock throughout town, but Ryouga was taking every opportunity to rub Ranma's face in it mercilessly. Akane was rankling him for not figuring it out sooner, and Genma had been telling Ranma how he wasn't half the martial artist his father was in his youth (2). Nabiki had earned a small fortune (3), whilst Cologne's plot had come to light and the old crone had been forced to abandon her latest plan to force Ranma and Shampoo to marry. Ranma, Mousse and Kunou refused to comment on the whole affair. ******** 1) Well, relatively normal. This is still Nerima we're talking about here. 2) To which Ranma responded: "If you mean weight-wise, I don't doubt it for a second." 3) "Nobody laid a single bet on half of Nerima pounding Tsubasa's face in," she commented innocently. ******** Akane strolled along the road, a basket of groceries cradled in her arms. Ranma kept pace-despite his obvious impatience-on a nearby wall. She briefly wondered what obsessive desire drove Ranma to always take to walls, fences and rooves whenever possible. Pro- bably some pathetic macho need to look down-Akane gripped the basket more tightly-on all the women-she began to growl-whom he considered inferior. Her stride became purposeful. How _dare_ that stupid jerk consider himself better than them! (1) "RANMA NO BAKA!" she roared, swinging the basket at him. He barely evaded the attack, but ended up losing his balance and fell to the pavement. "What'd I do _this_ time?" he asked in genuine confusion. He stood up, rubbing his backside. Akane shook a fist at him. "You know what you did!" "I'm not a mind reader." "Like I want your perverted mind in my brain!" "Like anybody would want to read such a kawaiikune tomboy's thoughts!" Ranma retorted. If Akane wanted to fight, he was willing. Ranma had held in his seething anger and humiliation too long. He opened his mouth, preparing to deliver a stinging remark which would have led to instant violence. But he caught himself. Akane didn't deserve this, and he didn't have the time for it. Grumbling, he backed down. (2) "TOMBOY?!?" Akane shrieked, obviously unwilling to let it go just yet. "I'll show you a tomboy!" Ranma refrained from pointing out she was doing a fine job of that already, instead beginning to walk away, his hands in his pockets. "I'm not in the mood." "Who cares about your mood!" cried Akane, stamping her foot in tantrum-like rage. "Find somebody else to hassle," Ranma tossed over his shoulder, as Akane sprinted to catch up. "I don't even know why I came with you." "Well _I_ certainly didn't ask you." Akane was calming down, but was confused by Ranma's reluctance to argue. She wondered what was wrong with him. He seemed so... "A-akane?" Akane looked behind her. There, struggling to catch up, was Ryouga, whose coincidental arrival had brought an abrupt end to Ranma and Tsubasa's duel. He had managed to get himself lost on several occasions since then, periodically showing up to jeer Ranma. Akane smiled. Ryouga was a little strange sometimes, but he was still a good friend; always ready with an encouraging word or a helpful hand- unlike _some_ people. She just wished she knew what Ranma had done to make Ryouga dislike him so much. They had gone through too much for it to have been just about some old bread. "Hi, Ryouga," said Akane, allowing him to catch up. Yo, Mr. P," muttered Ranma absently, as he stopped as well. Ryouga smashed Ranma on the head, sending the smaller boy stag- gering backward. "Akane," he said, "am I glad I found you." "What is it, Ryouga-kun?" "Hey!" Ranma stood straight. Here, at last, was somebody he could explode at. "You hit me!" "I'm sorry," Ryouga said with obvious insincerity, "did I have to dress in girl's clothes to do that?" Akane backed away, resigned to the fact that this would come to blows. Ranma had been itching for a fight since the duel, and only Ryouga's periodic disappearances had kept it from occurring until now. The lost boy stepped into a combat stance. "I'm _trying_ to talk to Akane," he snarled. "I'll deal with you later." "Oh no," Ranma growled. "We'll deal with this right..." At that moment, something flashed from the sky, a whirling disk that passed a scant centimetre from Ranma's nose. It chopped into the ground and stopped spinning, and Ranma could see it was a...bandanna? He blinked. How had Ryouga thrown that from his angle...but upon second glance, he noticed two things. One, that Ryouga's face registered equal confusion to his own, and two, that this bandanna was done in the same pattern as Ryouga's, but was predominantly green instead of yellow. "RRRRYYYYOOOOOUUUUUUGGGGGGAAAAAAAAA!!!!!" The word echoed accusingly, and all three looked up. There, on a nearby rooftop (3) stood a boy, dressed all in green. He wore a green tunic with a vertical bar of thick cloth holding it together, and the sleeves were rolled up, revealing blue-green bracers on his forearms. His pants were a rich green, so dark as to be almost black. His face was boyishly rugged, with brown hair pulled back in a short ponytail and tied in place by a green and black bandanna. In his right hand, he held a...plunger? Yes, a plunger, which he slapping the shaft of into his palm. "YOU!" Ryouga roared. He pulled his umbrella from its sheath, Ranma completely forgotten. No more words were exchanged between the two, and at some unspoken signal they both leaped. Ryouga flew up like a rocket, his umbrella cocked back and ready for launch. His opponent dropped like a meteor, his plunger held down at his hip and crossing his back. The lost boy fired off his umbrella, sending it spinning through the air at his intended victim. But whomever that was, he was ready for it, as he snapped his plunger out and stuck it into the wall behind him, stopping his downward plunge. Consequently, the umbrella chopped into the wall just below his feet. Then, in a flash, he dropped onto the misfired weapon, jarring it loose, and leaped high up and over Ryouga, landing nimbly on his feet. Meanwhile, Ryouga finished his leap and landed next to the building. Snatching his umbrella, he whirled to face his assailant. The two stared-glared would be more accurate-at each other from across the street. Akane turned to Ranma, discovering that he was seated on the section of the wall he had fallen off earlier, watching the unfolding drama with great interest. "What are you doing?" she barked. "Watching," he replied, in a tone that suggested he doubted her comprehension skills. "So what do you plan to do about this?" she asked, letting the comment pass but filing it away for future reference. "Continue to watch," he replied blandly. "I'm just glad that nobody here is out to kill me...for once." Meanwhile, Ryouga and his nameless opponent continued their staredown. Finally, the stranger broke the silence. "Nice move," he said, his voice unusually deep for a teenager. "Ditto." "Shall we?" "Your move." And the battle continued. The two combatants sprinted at each other, meeting just on Ryouga's side of midway. They began to exchange blows, Ryouga spinkicking at the stranger's head, while the other backflipped, almost tagging the larger boy with his feet. The stranger took the offensive, coming in with three short jabs from his plunger. Ryouga dodged the first and par- ried the two follow-ups with his umbrella. But he had been thrown off balance, and the stranger struck, his foot sweeping Ryouga's legs out from under him and his plunger descending like an axe at his head. At the last moment the lost boy saved him- self, dropping one hand to the ground and holding himself up with it while he unfolded his umbrella to catch the blow. At the same time, he launched his feet outward, both of them connecting solidly with the boy in a blow Ranma knew would have sent him flying. But the boy only grunted in pain and shifted his weight to keep his balance. With a quick sweep, he ad- hered his plunger to the top of Ryouga's umbrella. Moving too fast for Ryouga to tighten his loose grip on the weapon, the boy sent it flying. Ranma watched intently as both of them moved back; the stranger in green because he was clutching bruised ribs, and Ryouga because his armed opponent was between him and his weapon. "He's good," Ranma said critically. The stranger's fighting style seemed to be partway between Ranma's own high mobility kempo and Ryouga's power reliant, almost blitzkrieg martial arts. Ranma was now twice glad that whomever it was hadn't attacked him; he would really have been in for a fight then. "You always fall for that," the boy in green smirked. "How're those ribs?" Ryouga retorted. "I've had worse." "Ditto." And the fight was on once more. Ryouga had to deal with the extra reach his opponent had thanks to the nearly metre-long plunger, but the stranger couldn't fully capitalize on it because of his aching ribs. Finally, Ryouga worked his way in under the boy's guard, but his opponent had obviously been waiting for that and leaped up, driving his knee into Ryouga's side. Ryouga rolled away, and Ranma knew that if he had delivered a similar blow, the lost boy would barely even have felt it, but now he was gritting his teeth in pain. This time there was no reprieve as the stranger pushed in mercilessly, landing a solid blow on each of Ryouga's shoulders with the shaft of the plunger. Ryouga grimaced as his arms dropped, almost imperceptibly cupping his hands at waist level. Confident that he had knocked down Ryouga's defence, the boy leaped into the air and began a descending swing at Ryouga's head. He might have been right once, for the injuries to Ryouga's shoulders meant that any conventional defence would probably have been useless. But Ryouga wasn't planning anything unusual, and as the stranger in green came down, a sphere of green force began to form in the lost boy's hands. With a growl, Ryouga leaned back and thrust his hands upward. "SHISHI HOKODAN!!!" he roared, and the giant ball of depression-fuelled energy crashed into the stranger, sending him flying across the street to slam unceremoniously with the wall. He remained plastered against it for a moment, then stumbled forward and nearly fell on his face. Valiantly using his plunger to keep his balance, he watched helplessly as Ryouga stalked towards him. "H-how did you do that?" the boy gasped. "You like?" Ryouga was standing over the stranger now, his expression confident. The boy looked up and suddenly grinned. "Yep. Hope you like mine!" Somehow he was not only still conscious after the move, but showed he was still able to move as well. (4) Ryouga blinked as the green-clad boy suddenly lurched off the ground, face down and legs locked upward. "DENTENHA!!!" Suddenly a bright blue glow formed around the rubber circle of the plunger, which was still on the ground. There was a loud crackle like a bolt of lightning, and a paper- thin circle of light shot out, expanding until it reached Ryouga's feet. Unwittingly the lost boy broke the circle, and the entire thing snapped like a snake and spread up Ryouga like water. He was suddenly imbued with a hissing blue corona that threw white lines of force from his body into the ground. In less than a second it was over, and Ryouga remained upright for a moment, steaming. Then, with a groan, he collapsed onto his back. The stranger, exhausted by his move and hurt more by the Shishi Hokodan than he had let on, fell beside him. Both laid on the scorched pavement, breathing heavily, unable to continue. Ranma leaped to the ground. "Not bad," he said critically. "Not bad at all." "What are you talking about?!" Akane barked. "We have to help Ryouga!" "He can handle it," chuckled Ranma. "The other guy doesn't seem to be in any better condition than he is." "Your loyalty to your friends is staggering," said Akane, her voice dripping with sarcasm. "Who said me and Ryouga were friends?" Meanwhile, the two combatants were stirring. Ryouga's phenomenal endurance had him moving first, but the boy in green wasn't too far behind. They both raised themselves up onto their hands and knees, shaking with the pain of their injuries, and stared hard at each other, their faces only a couple of feet apart. Breathing heavily, they slowly regained their feet. The green one winced and clutched his ribs, Ryouga's arms were almost limp. Then, in one of those split seconds Ranma found himself getting used to, the aura of menace fell out of the air as they both grinned like loons. "What was that about how'd you do that'?" "It's just a little thing I do." Then they both grasped each other in a long and joyous hug. Both of them cried out a single word, a word which caused Ranma to wince and Akane to blink. "BROTHER!" ****** 1)The word "suspicious" doesn't even _begin_ to describe Akane where Ranma's concerned. Of course, she hadn't been having a good day either, and was kinda bad-tempered...yes, even more than usual. 2) An unusual day, indeed. Ranma backing down from a fight with Akane? Ranma: Well what do ya know? The moon's blue tonight! 3) Akane wondered here why it was _always_ a rooftop. Come to think of it, _I_ kinda wonder about that too. Anybody know? 4) Ranma decided later it was due to Ryouga's joy over his rival's recent humiliation, thus reducing the strength of his depression. ******** Takeru Hibiki was Ryouga's younger brother, and the middle child of the family. He and Ryouga and their younger sister Akemi had lived with their parents in a house where you could see Mount Fuji from the window-beyond that Takeru was a little vague. The three trained together, learning the secrets of the Hibiki's school of martial arts. Each had learned the in- tricacies of the bandanna, a universal weapon among Hibikis, and had early on chosen their own weapon. For Ryouga an umbrella, Takeru had taken up the plunger, and Akemi had wanted a giant toothbrush. The three had been more than siblings; they had been comrades and friendly rivals. Of course, they had also inherited the Hibiki family curse-the worst senses of direction imaginable. But the curse started out mildly and became worse as they got older, so despite two or three day stints they managed to remain pretty close. Despite the shared heritage in curse and fighting style, the Hibikis had developed very different personalities. Ryouga was shy, loyal and helpful, but had an explosive temper which was triggered by the strangest things. He lived by his own code of honour and anything that rubbed against it would set him off, but one had to admit it gave him a tenacity that few others possessed. Akemi, in contrast, was protective, outgoing and easy-mannered. She seemed to have at some time decided she was the world's "big sister". She looked out for the underdog, always seeking a new cause to support, never tired by fighting the good fight. She also seemed somewhat miffed that she had missed out on the crusades or some other noble time when she could have left on a quest to crush the infidels and protect peace, justice and liberty. Takeru was the most level-headed of the three (1). Inquisitive by nature, Takeru was an explorer, always looking for new knowledge, wherever it might hide. Consequently he was the smartest of the trio, and had become the unofficial leader. However, he had little control over his emotions. Some called him flighty, others called his mood swings eccentric. He called it what it was: "the emotional stability of an intoxicated moose". Takeru was a year younger than Ryouga, so he hadn't been enrolled in the school where his brother had first met Ranma Saotome. He had heard about the bread crisis, and tentatively suggested that Ryouga bring a lunch, but that had fallen on deaf ears. Akemi had stated she would go forth and smite the evil delivery person for not supplying more bread. The other Hibikis hadn't seen her since, except occasionally on TV where she would be at anti-nuclear or anti-war or anti-pollution or anti-protest rally rallies. When Takeru had heard of Ranma's disappearance before the big fight (2) he became inflamed with righteous indignation and literally dragged Ryouga in pursuit. This quest had lasted a whole week-a new record-before Takeru had been distracted in a market by Vilian. Vilian was an occultist, a researcher into the arcane and paranormal. Ryouga by this time was in full revenge mode himself, so Takeru had told him he wanted to explore the mysteries of the universe, the intricacies of space and time, and pick up a cheeseburger around the corner. He and Vilian had gone for the food, and until now Ryouga and he hadn't seen each other. Of course, after that...unmentionable incident at that...unmentionable place he and Vilian had parted ways. Takeru had had enough of the arcane after only six months, and he had wandered the globe for the last few years, living with the price of his brief foray into matters better left unexplained by man. Now he and Ryouga were together again, something Takeru had been looking forward to since hearing about Nerima from that Tarou guy. Takeru and Ryouga broke their brotherly embrace and stepped back. "Long time no see." said Takeru. "Where have you been?" asked Ryouga, not one to mince words. "Here and there," he smiled. "You know how it is." "Hai." Ryouga gripped him by the shoulders and smiled genuinely. "I missed you, bro." "Ditto." "Ahem." The reunited brothers turned as the sound of someone clearing their throat caught their ears. Ryouga silently chided himself. The girl of his dreams stood looking on expectantly, with he boy of his nightmares not far behind. "Akane!" he blurted. "How forgetful of me! Akane, this is my brother, Takeru Hibiki. Takeru, this is my...friend Akane Tendo." "Pleased to meet you," she said politely, bowing. Takeru smiled and returned the bow. "Charmed," he murmured, noting out of the corner of his eye that the as-yet-unnamed other boy was glaring at him. Stepping back, he took a long look at his brother, and noticed the expression on his face as he gazed at Akane. Two and two fell into line, and Takeru, who was considerably more perceptive to his brother, guessed something that hit pretty close to the mark. "Hey!" said the boy. "What am I, chopped liver?" "It can be arranged," growled Ryouga, and Takeru leaped to another conclusion that would turn out to be correct. After all, he remembered that these two had been about to come to blows before he had interrupted. Ryouga sighed. "Takeru, meet Ranma Saotome," he said with a distinct lack of enthusiasm. Takeru blinked. Saotome... "Wow, you're still alive," he said with amusement. "A temporary condition," muttered Ryouga. He and Ranma glared at each other with undisguised dislike. "I'd say it's nice to meet you, but it isn't," commented Takeru. "What you did to my brother was really cruel." "You know about that?" Ranma said, looking surprised. "Of course, he told me all about it." Takeru paused. "And if I wasn't half-dead I'd probably pound you once or twice." "You and what army?" growled Ranma belligerently. "Hey, nothing personal," Takeru said, his hands up. "Just being brotherly, but I think you should relax a bit. You're looking for enemies everywhere." For a moment Ranma looked like he was about to respond hotly, but their was some- thing in his eyes...surprise? anger? pain?...something Takeru couldn't read. Then in a flash it and his unvoiced retort dis- appeared as the boy turned to leave, kicking a stone angrily. "I'm going back to the dojo," he grunted. "Hey you!" Akane said angrily, turning to face him. "Don't be so impolite! Get back here!" She ran after him, yelling about how impolite and rude and useless he was, and vividly describing how much pain he'd be in if she ever got her hands on him. Takeru scratched his head. "What's their problem?" "That jerk Ranma is always doing this to her!" Ryouga clenched his fist. "I should..." "Settle down, bro." Takeru laid a calming hand on Ryouga's shoulder. "Let's not be hasty here. What you have to is make a plan." "A plan?" asked Ryouga. "Hai," Takeru grinned, "a plan that will make her hate him like nothing else. A plan, I happen to think I can come up with." ******** 1) Yeah, so that's not saying much. 2) He _had_ wondered why some guy had been standing in the backyard for three days, but had decided it was none of his business. ******** Ucchan's was closed for the day. In fact it had been closed for most of yesterday too, mainly due to the fact that practically all the conversation had revolved around Tsubasa. Ukyou was pleased that the freak was out of commission for awhile, but her spirits were dampened somewhat by the continual reminders of the events leading up to his defeat. So for the first time in several months, she found herself with free time on her hands. That was quite unusual for her. Since she had first arrived in Nerima she had always had a purpose to her movement. Most of the time it was either her restaurant or her school. Then there was sleep, cleaning, and homework, all of which left her with only an hour or so to do what she wanted. Inevitably that time was spent chasing after Ranma. But now she couldn't. It wasn't any physical or social restraints that prevented her from walking to the Tendo dojo and hanging around, but rather an...emotional one. She just didn't feel like it. It was strange, but she wasn't able to gather up enough enthusiasm to head over. So she laid on her bed and tried to relax. Despite her attempts to counteract, inevitably her thoughts drifted to Ranma. What was it that made him so reluctant to commit? Why couldn't he just face his feelings and act on them? She sighed. After a while she walked downstairs, deciding to have a quick bite to eat and then perhaps catch up on her training. She had been letting herself slide lately, too tired or too preoccupied to train. She realized she wasn't as good as she used to be and accepted that, after all, she didn't really need martial arts. No, Ranma wouldn't love her for her skill, he would love her for her. At least, that was what she hoped. She was just entering the kitchen when two people were exiting it, and she slammed into them. Stumbling back, her mind raced with images of burglars, murderers or worse. Realizing that the two had been surprised as her, she took advantage of their hesitation to snap out her combat spatula. "Ukyou?" She stopped, startled, and looked straight into Ryouga's face. She was baffled by the fact that he had just come out of _her_ kitchen, but accepted it with the calm gained only through many months of living in Nerima. Looking over at his companion, she wondered who he was. He was dressed in a multishaded green outfit with hair tied back by a green/black bandanna. He was slightly shorter than Ryouga, and his face showed a definite family re- semblance. Strapped to his belt was a nearly metre-long plunger. "Hi, Ryouga. Who's your friend?" The boy smiled winningly and bowed. "Takeru Hibiki, Ryouga's brother," he explained. "And I have the pleasure of meeting...?" "Ukyou Kuonji," she said, returning the bow. She was im- pressed by his politeness but held off judgement. Too often in Nerima people weren't what they first seemed... "Charmed," replied Takeru. "I must apologize for my bro- ther's and mine own rude entrance but..." he shrugged, "it's a curse." "Hai," Ukyou said pleasantly, deciding she may as well be nice. There was no sense in judging people by their family ties, after all. "I was wondering if you could point us in the direction of the Tendo dojo," he said. "We could use the help." "Over that way." Ukyou vaguely gestured in a random direction, knowing full well that even if she gave them a precise map of Nerima, a star chart, a compass, a tracking dog and a set of very detailed instructions, they would still get lost. "Arigato," said Takeru, and dragged Ryouga off in the exact opposite direction from the one she had indicated. It was only after he and Ryouga were out of sight that Ukyou wondered _why_ exactly they had wanted to go there... ******** "Who was that girl?" Ryouga blinked. He and Takeru were sitting on a rooftop across from the main gate of the dojo. He looked at his brother in confusion. "What girl?" "The one who gave us such good directions," Takeru replied, tossing his plunger up and catching it like a baton. "Ukyou?" said Ryouga in disbelief. "Yeah, I assume you know her." Takeru flipped his plunger again. "Well...uh...she's Ukyou," Ryouga replied. "She likes to cook...especially okonomiyaki, and runs that restaurant...and... uh..." "She's cute," said Takeru, looking off into the sky. Ryouga stared at him. Was Takeru saying what Ryouga _thought_ Takeru was... "She got a boyfriend?" "You _could_ say that," he said carefully. "She's kinda engaged." "ENGAGED!?" gasped Takeru. "But she can't be over seven- teen! How could she be engaged?" "It's the truth, bro," Ryouga replied. "Though I don't know what she sees in him." Ryouga recognized what happened next, as Takeru entered one of his trademark depressions. His body slouched, his eyes downcast, his mouth quivered, and finally his head lolled forward. Suddenly Takeru's head shot up, and he looked like he was ready to scale Everest. "Alright, I think it's time you told me more about this Ranma. I'm going to need to know all I can before I can think of a way to solve your problem." Somebody else might have been thrown off-balance by the sudden mood swing, but Ryouga knew Takeru well enough to be used to them. "Well, he's a jerk," Ryouga began. "And the only reason Akane puts up with him is because she's been forced into engagement with him." "Forced?" said Takeru curiously. "Yeah, her and Ukyou..." "Wait a minute." Takeru held up his hand. "Ukyou's engaged to Ranma, who's _also_ engaged to Akane?" "Hai," Ryouga nodded. "And Shampoo. He's engaged to her too, sort of." "Shampoo!?" Takeru looked shocked, then calmed down. "Must be a coincidence," he muttered, and then stood up, looking angry. "Obviously, Ranma's more than just a jerk." His voice raised a few decibels. "He's a monster! A womanizer! I'll take pleasure in removing one of them from his grasp!" Takeru was brimming with righteous indignation. Thunder boomed, and Ryouga realized that low, dark clouds had crept in overhead. He hastily pulled out his umbrella and unfolded it over his head. It was only then that he risked a glance at takeru, who was staring at the encroaching storm in sudden horror. "Takeru?" "Ah...c-can we g-go inside now?" Takeru stammered, even as he headed for the edge of the roof. "What's wrong?" Ryouga asked, stepping towards him. "N-nothing...let's just..." Thunder boomed again, cutting him off, and a raindrop splattered against Ryouga's umbrella. Takeru gulped and leaped off the edge just as it began to pour. Takeru!" Ryouga cried. He wasn't sure what was happening, but he knew he had to protect his brother. He leaped after him, but in his haste he forgot to keep his umbrella up... The man who had been walking down the street, collar clenched tight to keep the rain from going under his jacket, got a surprise when a black, squealing object fell in front of him, followed by an umbrella which put a crack in the sidewalk and a set of clothes that drifted on top of his head. The piglet pulled itself up and quickly dashed into an alley where he could hear footsteps moving away. The man blinked, then shrugged, threw off the clothes and continued on. Just another one of those things in Nerima he didn't understand. ******** Ryouga was moving as fast as his little pig legs could carry him, but he couldn't seem to catch up with Takeru, who was running at top speed for some reason. As he exited at the other side of the alley he thought he caught sight of his brother running into another alley. He seemed to be shorter than Ryouga remembered, but maybe that was just the influence of his different perspective. Running towards the other alley he heard a gasp...but it wasn't Takeru's voice. He slowed down and cautiously began around the corner. "Don't come around, Ryouga!" a voice far too high-pitched to be his brother's cried. "I can't hear you, but I know you're there. I don't want you to see me like this." Whoever it was, they seemed practically on the verge of tears. Ryouga slowly stepped around the corner, and his little piglet eyes widened in disbelief. There, leaning against the wall and breathing heavily, was a figure. The figure was dressed in Takeru's clothes, even had his plunger on the belt and hair tied back by the bandanna. But this person, who was frantically scanning the turn for any sign of pursuit and completely missing P-chan, was _not_ Takeru. In fact, the figure was a woman. ******** Ukyou was halfway to the Tendo's when the rain caught her. Thus, she was running when she turned around the final corner and literally stumbled over Ryouga's umbrella. She fell forward with an "eep!" and only her innate reflexes saved her from skinning herself. She did, however, get thoroughly soaked when she splashed into a large puddle. Pushing herself back up on her arms, she glared at the off- ending accessory. As she stood up, though, her anger was replaced by curiosity. Here was Ryouga's umbrella-open and imbedded in the pavement-and his clothes. Obviously, he had been caught unawares by the rain. But why hadn't his brother gathered up his stuff? She wondered about that for a moment, then decided to let the mystery go unsolved for now. She needed to dry herself off, and what better place to do that then at the house across the street? Pushing Ryouga and all Hibikis from her mind-at least for now-she started over. ******** The woman in Takeru's clothes stepped forward. "Ryouga?" she called softly. She couldn't see the person she was looking for, because he was a little black piglet at her feet. "I guess he didn't follow..." Now that Ryouga could take a better look at her, he noticed several other differences-besides the obvious physical ones-between this girl and Takeru. Her hair was bleach white instead of brown, and her eyes were lighter too. The girl in Takeru's clothes-Ryouga couldn't think of her in any other way, but a suspicion was growing-sat down. "I can't let Ryouga see me like this," the girl said, clenching her fists and closing her eyes tightly. "The shame is too much..." She looked like she was going to cry, and Ryouga felt a strange pull towards her. An almost...brotherly need to comfort. Without quite thinking about it, Ryouga trotted forward and bweed in concern. The girl's head snapped up, and she looked at P-chan in surprise. "A piglet?" She stared at him, then suddenly smiled. "I was running from a piglet." She let out a relieved chuckle, and it was if her sadness of barely a few seconds before had never existed. "Come here," she called softly, patting a dry spot near her. "I guess you're lost too, huh?" Ryouga trotted over, bweeing in curiosity. She patted him once, then leaned back. "What's your name, little guy?" "Bwee-wee-wee," Ryouga replied. The girl smiled, then abruptly got a serious look on her face and stood up. "Well, we can't stay here forever," she pronounced. "I guess I might as well find your owner, and a hot bath for me." Ryouga didn't know how, but he was almost sure of the truth now as Takeru-chan reached down and picked him up. ******** Ukyou was drying her hair with the towel Kasumi had provided when Akane entered. "It looks like it's getting worse out there," she commented, sitting down. Ranma sat crosslegged, looking out the patio door to where the pouring rain continued unaba ted. In the distance lightning flashed, followed by a roll of ominous thunder. "I'm just glad I didn't get caught in it," Ranma said after a moment. "And I'm sorry I did," stated Ukyou, not really feeling that way at all. "And if it doesn't clear up, I'm likely to catch cold on my way back across town." "Try lots of bed rest," Akane offered shortly. Ranma looked caught between two opposing forces, then finally sighed. "Why don't you spend the night here?" he said reluctantly. "I'm sure it would be okay." "Oh Ranchan!" Ukyou leaped up. "I _knew_ you wouldn't let me get soaked!" She smiled happily. "I doubt dad would let her stay, Ranma," Akane said angrily. "Well I'm sure he wouldn't kick her out in this storm," Ranma replied. Ukyou sat back down and watched the escalating argument with a sigh. "Why doesn't she just take an umbrella?" "In this wind?" Ukyou said mildly. "I'd be lucky if I didn't blow halfway to Hokkaido." "What's your problem anyway, Akane?" Ranma asked. "It's not like I'd be sleeping with her or..." "Sleep with her!" Akane bellowed, and Ranma realized too late his mistake. "I'm sure you'd like to do that, you pervert! Just trap her here and have your own little harem!" Ukyou noted Akane's rage with a practised eye, and decided to play her trump card before things got totally out of hand. "Aren't you worried, Akane?" "About WHAT!?" she practically screeched. "P-chan. I saw him outside and assumed you'd let him out for awhile." (1) The anger drained out of Akane in a flash. "My P-chan is out in that terrible storm?" she gasped. Akane spun around and ran for the door, snatching up a raincoat on the way. "I've got to find him!" "Why's she so worried about that pig?" Ranma grumbled. He started to get up, but Ukyou swiftly moved to block his exit route. "Now Ranchan," she said soothingly. "Let her chase after that jerk Ryouga. I'm sure she won't go too far." She smiled. "Besides, it isn't polite to leave a guest all alone." Ranma grimaced. He was caught, and she knew it. Now, all she had to do was get in close enough... ******** 1) It wasn't exactly a lie; after all, she'd seen _evidence_ of P-chan. ******** Akane stood looking down at Ryouga's umbrella (1) and wondered why he would leave it here, in the middle of a thunder- storm. She knew she couldn't lift it, so she decided to just remember where it was and lead Ryouga to it later. Steeping around it, she walked further down the street, holding her hood tight over her head. Despite the waterproof coating of her raincoat she was still getting wet from the nearly horizontal sheets of water. She looked all around the dojo. Checking the places where P-chan could usually be found, but there was no sign of her pet. She was about ready to give up- besides, Ranma and that bimbo were alone together-when she heard a soft, familiar sound. "P-CHAN!" she yelled as she heard the squeal, and was instantly in motion. She ran down an alley, P-chan's bwees becoming louder all the time, and nearly slammed into a girl coming down from the far end. Only the girl's quick reflexes kept them going down in a tangled heap, as she snapped out the long shaft at her waist, stuck it to the wall and used it to flip over Akane, who couldn't stop on the slippery ground. Finally managing to skid to a halt, she turned to face the girl. That green outfit looked awfully familiar... "Akane?" she said in surprise, and instantly seemed to regret it. "Do I know you?" Akane asked. The girl still seemed familiar, but Akane couldn't think of where she might have seen this strange white-haired girl before. Then Akane heard a familiar squeal, and looked down to see P-chan tucked under the girl's arm. "P-chan!" she exclaimed in delight. "He's yours?" asked the girl, lifting the happily bweeing piglet up. "Hai!" Akane took hold of him and hugged him fiercely. P-chan made contented sounds. "Well it looks like one of us will be warm tonight, little guy," the girl said, and turned to leave. A peculiar thing happened next, as P-chan suddenly started squealing forlornly and waving his little hooves at her back. Akane looked at her pet strangely, then came to a decision. "Wait. Do you mean that you have nowhere to stay?" The girl stopped and looked back at her. "Hai," she said carefully. "Then you can stay at my place!" The girl turned and held up her hands as if to fend Akane off. "I couldn't, you don't even know me. I couldn't impose." "Nonsense!" Akane cried. "You're a decent person: you helped little P-chan here, right? And you seem to know me." {Besides,} she thought, {if this girl takes up our only spare bed, I can kick out that bimbo Ukyou.} Akane grabbed the girl's wrist and started dragging her down the alley towards the dojo, chatting amiably about how they'd soon be good friends. With a look of resignation on her face, the girl had no choice but to follow. ******** 1) The clothes having been blown away by the increasingly heavy winds. ******** Ukyou had managed to manoeuvre her and Ranma onto the same couch, and now was moving slowly closer. She had noted that Ranma and Akane had fought a lot more often since the duel with Tsubasa. Akane, whom Ukyou guessed was embarrassed over the concern she had shown for Ranma when they all thought he was doomed, had become increasingly foul-tempered, and Ranma had responded in kind. Now, with the two of them almost constantly fighting, was the perfect time for Ukyou to snare Ranma and get him to make a choice, which would, of course, be for her. And now she had the opportunity she'd been waiting for. {No escape for you this time, Saotome,} she thought. Ranma, meanwhile, was thinking along the same lines, but with somewhat less enthusiasm. He looked around, desperately hoping Nabiki or Kasumi would pop in. But Nabiki was up in her room working on that project she had started after making a mint at the duel, and Kasumi was preparing dinner. Even Genma or Soun would have been a help right now, but Happousai had implicated them when caught in his latest panty pilfer and all three were in hiding. "Ranchan," Ukyou said softly, "You were so generous to let me stay here instead of sending me home in that storm." "Don't mention it." Ranma said weakly, backing away. Ukyou inched closer and Ranma had nowhere else to go unless he literally climbed the wall or ran out, and he didn't want to insult Ukyou by doing that. Besides, what was so bad about staying? Ranma knew that answer, but tried hard to ignore it. "Any friend would have done the same." "Maybe," Ukyou conceded, now sitting right beside Ranma. "But shouldn't friends _thank_ each other?" Ukyou leaned in for the kill. Ranma watched in mild horror as she came closer, her eyes closing in anticipation. Ranma was besieged by conflicting feelings: his natural male impulses-go for it!; his macho tendencies-who needs her?; his own feelings towards Ukyou-she's your best friend!; and Akane-??? On top of all that she seemed determined to continue despite his condition... and she did smell nice...and wasn't ugly or nothing... Ranma yelped in pain as somebody grabbed his pigtail, roughly yanked him off the couch and dumped him unceremoniously on the floor. He opened his eyes and saw the angry face of just about the only person he _hadn't_ wished to show up. It figured. "What do you two think you were doing!?" yelled Akane, with her fists on her hips and an icy glare in her eyes. "Oh well." Ukyou snapped her fingers. "Better luck next time." "Be quiet and stay out of this!" Akane growled. Ranma cautiously regained his feet. The back of his skull still ached from her rough intervention and he found his temper rising. "I don't see it's any of your business _what_ I was doing, Akane," Ranma said, with perhaps more of an edge than he really meant. Akane flared up and Ukyou cautiously removed herself from the blast radius with a mental groan. Why did Ranchan always do this? "None of my BUSINESS!?" Akane roared, "This is most _definitely_ my business!" "Why's that?" Ranma asked, less angry than Akane but still comparable. "It's not as if I'd ever be involved with a kawaii- kune tomboy like you." "_What_ was that!?" "Maybe I should be clearer. You're an uncute, gorilla- faced, flat chested, jealous impolite tomboy with all the sex appeal of a slug, and I wouldn't be caught dead even _thinking_ of being with you!" Akane's facer had gotten more and more enraged as Ranma's insults continued, and as he finished she finally hit meltdown. With an inarticulate scream she pulled the Almighty Mallet (tm) out of nowhere and smashed him. She not only managed to flatten Ranma, but also cracked a few floor- boards in the process. "Think about that!" she said after a moment. "That was a trifle overdone, don't you think?" murmured Ukyou, though whether she was saying it to Ranma, Akane, or the authors of this fanfic was unclear. Akane pulled the mallet off of Ranma and tossed it away. Pulling the dazed boy to his feet, she pointed at Ukyou. "And tell your trollop to get lost," she said smugly. "Somebody else needs the space." "Trollop?" Ukyou objected. "I am _not_ a trollop." "Who?" asked Ranma weakly, partially recovered but still hurting. "Her..." Akane began. "No, I meant who is supposed to take Ukyou's place?" "Why her, of course!" Akane turned to the patio where she had left the mysterious girl and P-chan, only to find them gone. "Nani?" Ranma and Ukyou exchanged glances. "She's finally snapped," said Ukyou clinically. "Happens to all tomboys," Ranma agreed. Akane smashed her fist into Ranma's face and was out of the room before he collapsed. ******** Ryouga hadn't seen what was happening in the living room, so when Akane had dropped him suddenly, he hadn't hesitated with what he had to do, what he _had_ to do. Therefore, within seconds of touching the ground he was tugging on the girl's leg with all his pigly might. She didn't appear to notice for a moment, then looked down and raised an eyebrow, obviously unwilling to draw attention to herself by speaking. P-chan drew himself up on his hind legs and tried to com- municate his intent with sign language. First he rubbed his hooves in his armpits, then mimed washing his chest while singing mutely. "The bathroom?" she whispered. P-chan nodded and pointed off in the direction where the room in question was. "What a smart pig," she smiled. "Well lead the way, then." Ryouga set off at a brisk trot, the girl easily keeping up. Now, Ryouga was very familiar with the layout of then Tendo dojo, so after about ten minutes-and only once leaving the building!- they found the bathroom. "Nice set up," she sighed, walking forward. "If Akane was going to let me stay for the night, I'm sure she won't mind me using the bath." Ryouga trotted after her, but in her haste the girl had forgotten completely about her guide, and she slid the door shut in front of him. Ryouga waited impatiently as the sound of water filling the tub hissed beyond the barrier. The girl on the other side hummed happily, and he heard her clothes-Takeru's clothes-slide to the floor. Ryouga was practically bristling with impatience when he heard the splash of her lowering herself in, and her voice deepened significantly into a sigh of relief. Now he knew, and with some effort he opened the door slightly and squeezed in. There, sitting in the tub with a surprised look on his face, was his brother Takeru. Oh no, Ryouga tried to say, but it only came out as a squeal. "Hey!" Takeru yelped, "How did you..." Before he could finish, P-chan leaped into the hot tub as well. Takeru's eyes widened in disbelief as the inevitable change occurred. "Hello, brother," Ryouga said with a sigh. "I see you've been to Jyusenkyou." ******** Ryouga and Takeru were still in the bathroom, though both were now dressed (1). The older lost boy was finishing his story, telling how he had followed Ranma to Jyusenkyou and how he had been knocked into the cursed springs. He didn't mention his earlier trouble distinguishing between Ranma-kun and Ranma-chan; in fact, he didn't even mention Ranma's curse at all, figuring that Takeru could only handle so much at once. He related bitterly how Genma and the guide had almost cooked him for dinner, then sat back with an irritated frown. Takeru, on the other hand, was practically blubbering. "How tragic!" He blew his nose noisily. "My own brother cursed by the same ground that claimed me! Surely the Hibiki's are cursed by the gods!" "It's not that bad..." Ryouga began half-heartedly, but was cut off as Takeru's eyes filled with anger. "No!" he roared. "It _is_ bad! In fact, it's horrible! To think that Ranma Saotome not only womanizes, but wantonly tortures people with this curse! I must _destroy_ him!" With some difficulty, Ryouga grabbed his brother's shoulders and forced him to stay. "Calm down," he said, wondering that he of all people was telling someone to do that. "I know how you feel, but Ranma is _mine_. I'll get revenge on him myself." "Hai," Takeru sighed. He relaxed, then suddenly perked up. "But this is great, too! Now you really _can_ under- stand my problem and help me!" Ryouga nodded. "I think you should tell me all about _your_ curse now, bro." "Hai. It's about time I got this all off my chest anyway," he said. "It all started long ago, when Vilian and I were still travelling together..." ******** 1) Ryouga having retrieved one of the numerous sets of clothes that were stashed around the dojo. ******** Takeru was a lot younger then, though he was unsure of the precise timeframe involved-he guessed it was about when he was ten or eleven. He had been walking with Vilian in the mountains of China, amusing himself with games of hit- the-tree-with-the-bandanna or toss-the-boulder. Vilian was about twenty years old, and was quite attractive-not that Takeru took much notice of such things at his age-with shoulder- length black hair and pale, almost white, skin. Her most distinguishing characteristic was her walking stick, a long affair made of a mysterious naturally blue wood, covered with incomprehensible symbols, and topped by a softball-sized amber crystal. She had taught him a new technique about a month ago; a good one that allowed him to channel his bioelectrical field into other objects-the ground was easiest-and deliver shocks. He remembered the two times he had fought monsters with pride, and the victories he had won. Not that they were much: just an imp and an old sura-kappa, but still it was an accomplishment. Now Vilian always wanted to learn new magic, and had heard of a tribe deep in China where it was rumoured that magic was still practised. Finally they had found this village: "Jutsetsuka" Vilian called it, or something similar. Takeru wasn't all that interested; he could see some kids his age down there, and he ran towards them happily. Vilian came after him, and arrived just as Takeru was introducing him to one of the kids. The boy blinked, his pop-bottle glasses perched pre- cariously on his nose. He was only a year or two older than Takeru, but he was the oldest child there and Takeru assumed he was some sort of leader. After an uncomfortable moment of silence, Takeru realized what was wrong and reintroduced him- self in Chinese-a language Vilian had been teaching him with great success. "I am Mousse," the boy responded. Takeru blinked, but decided it would be impolite to make a comment on the strange name. He noted absently that Vilian was talking was talking to some old woman, and then turned his attention back to Mousse. "So what are you and your friends doing?" "These are not my friends," Mousse replied cooly. "They are my punishment for pursuing my love. I am forbidden to stay with the older children." "How s-sad!" Takeru's voice quivered with real pity. "You get used to it," Mousse replied, although for some strange reason he addressed his reply to a nearby boy, who ignored him. "Who has done this to you!?" said Takeru in sudden anger. "Just about everyone," Mousse said, sitting in a cross- legged position. "Well, I can't beat _everyone_..." Takeru murmured, taking out his plunger and spinning it like a baton. The Chinese boy regarded him carefully for a moment. "You are a martial artist?" he asked. "Hai," said Takeru proudly, "and I've beaten eight super- natural monsters!" (1) Mousse appeared to think for a moment, then stood up. "Well, then, perhaps you would like to spar for a bit?" "Why not?" Takeru said. They got into offensive posture, and then Takeru looked concerned. "You want me to get rid of my weapon?" "No," Mousse said with a smile, "you use it all you want." The two of them went at it. Takeru had to admit he was sur- prised when Mousse sent a dozen chained weapons at him, but he recovered quickly and managed to evade them all. The two ran about, Takeru having the time of his life trying to beat this mysterious bespectacled Chinese boy with the endless supply of weapons, while Mousse was sweating profusely. Finally, after nearly five minutes of intense dodging-during which he took more than a couple of hits-Takeru managed to knock Mousse's glasses off with one of his bandannas. He then leaped over the resultant burst of weapons, landed behind Mousse, and gently tapped him on the shoulder. "You're dead," Takeru said pleasantly. The rush of ad- renaline pounding through his body always put him in a good mood. "I am?" Mousse turned around. "You're better than I thought you'd be," he said thoughtfully. Takeru handed him his glasses, and Mousse put them on, all the while scrutinizing Takeru in a somewhat unfriendly manner, the effect of which was lost on the cheerful Hibiki. "Excuse me," said a voice, and Takeru turned to see an old woman, the same one Vilian had been talking to, was perched on a staff behind him. It was only then Takeru noted that everybody else in the surrounding area was staring at him. Mousse look ed at the old woman with obvious dislike and stepped away, fading into the crowd. "I couldn't help but observe your little melee," the hag continued. "Very impressive, es- pecially considering that Mousse is almost two years your senior." Takeru smiled. "Me and my bro and sis have been training since we could crawl." The old crone smiled disturbingly and turned to Vilian. "I have reconsidered. I shall teach you some of our village secrets if this boy can defeat my chosen champion." "I don't know..." she began. "Ah, c'mon!" cried Takeru exuberantly. "This is what I'm here for, right?" Vilian sighed. "It's your choice, I guess." "Excellent," the hag cackled. "The battle shall take place in the village centre in one hour." An hour later, Takeru was in the circular ring that resided in the centre of the village. Nearby, Vilian and the old woman- Cologne, Vilian had called her-were sitting and watching with interest. Takeru would later hear from Vilian what they were saying during the match, but at that moment he was concentrating on his opponent, a tall, purple haired girl about as old as Mousse. She carried two sphere-topped maces that Takeru recognized as bonbori, and had been introduced as Shampoo. He absently wondered what would happen when the villagers ran out of household products to name their children. "The rules are simple," Cologne stated. "In this combat, whomever is knocked out of the ring first loses." "Hope you enjoy the outside," Shampoo laughed. "You'll be seeing it soon." "May the best fighter win," Takeru offered, genuinely meaning it. He was never that really concerned who won, as long as it was a good fight...and an honest victory. "And that's Shampoo!" she cried, banging her bonbori above her head. The crowd roared. Takeru took out his plunger and twirled it in a display of excellent physical dexterity. "And...BEGIN!" Cologne shouted. Shampoo instantly charged, her bonbori held high over her head and a berserker war cry erupting from her lips. Takeru briefly considered just sticking his plunger in her chest and flipping her out, but was too excited to end it that quickly.(2) Instead, he sidestepped and used a jarring blow from the rubber top of the plunger to knock one of the bonbori away. After that it became a game of cat and mouse, with Shampoo the angry cat and Takeru the teasing mouse, always just out of reach. That's not to say it was an easy match, not at all. In fact, Shampoo was probably one of the best opponents he had ever faced. She had the advantages of experience, agility and speed, but her initial overconfidence led to several mistakes early on, which Takeru capitalized on with fast jabs to the leg and hip area, nullifying her superior speed. Then it settled into an endurance match, which suited Takeru fine because that was an area in which he had Shampoo beat. She would come at him, trying to corner him against the ring and use her amazonian strength to pound him to a pulp, but he would always vault, jump, duck or otherwise evade, usually managing to get a hit or two in the process. He did take hits-one particular blow to the ribs would ache for weeks- but when he wanted to, he could shrug off pain to a point. Shampoo, on the other hand, didn't seem to be able to take much punishment. After a minute she wasn't jeering anymore; after three the crowd stopped cheering. Finally, about ten minutes into the match, Takeru decided it was time to play his trump card. With a smile he leaped over Shampoo's latest strike and landed in the centre of the ring, his plunger firmly adhered to the ground and his feet safely off it. "DENTENHA!!!" he shouted, and a circle of flickering energy flowed out in a circular wave from his plunger. Shampoo was too tired to leap it, and her breaking the circle caused it to whip around like an angry snake and send a corona of blue-white bioelectric force into her. Instantly her nervous system was overloaded and she fell on her face. "He's a very strong boy," Cologne commented. "And appears to have won," Vilian replied. "It only remains for him to put my great-granddaughter outside the ring," she smiled, "and he will make an excellent husband." "Husband?" "You see," Cologne chuckled, "an outsider boy who defeats a woman of the tribe must marry her." "NANI!?" Vilian leaped up. "TAKERU!" Takeru, meanwhile, was lifting Shampoo into the air. He paused as he heard his companion's frantic yell. "What?" he called, disappointed that this really great fight was over. "Don't beat her!" Vilian yelled. "If you do, you'll have to marry her!" "Be quiet!" Cologne tapped Vilian's back, causing the woman to topple. "Finish it, boy!" "M-marry her? But I'm just a kid!" He hesitated, unsure of what to do. Then he was slammed to the ground as someone kicked him _hard_ in the back of the head. He slammed face- first into the ground and cried out as someone landed on top of him. A cheer erupted from the crowd as Shampoo lifted him up and turned him so she could smile evilly in his face-though she still seemed shaky-before she casually dropped him out of the ring. "Hah!" Shampoo sneered. "Shampoo wasn't worried for a second!" "Boy," Cologne growled, "you've made a _big_ mistake!" "Yes," Shampoo added, "People who refuse to fight get punished." "Take him to the springs!" Cologne cried, pointing her staff at Takeru. It didn't take long for the villagers to grab Takeru and drag him, kicking and struggling, out of the village and up into the nearby hills. Soon they were at a large field of ground dotted by irregularly-shaped pools of water, which had bamboo shoots sticking out of them like bristling hairs. The villagers dropped him at the near edge, and Shampoo held Vilian from behind, the latter's paralysis having worn off. "Welcome to Jyusenkyou, boy; the training ground of accursed springs." Vilian gasped in horrified recognition. "No!" She struggled futily. "You don't know what this will do to him, he's very sensitive!" "He refused to fight for a girl," Cologne pronounced, in that ringing tone that would burn forever in his memory, "So he shall get an appropriate curse. Throw him in!" Two bull-muscled amazons picked him up and threw him in the nearest spring. He fell into the water and chocked as it rushed into his mouth. He flailed his limbs, trying to escape, but this was no ordinary water; he could feel it burning through his veins like acid. His body seemed to revolt against it, but it fought a battle it couldn't win. Then he changed... gods, he could _feel_ himself change! He burst from the spring, crying out in a voice far too high-pitched to be his rapidly developing baritone, and shook his head, the cursed water flying off in droplets. Standing up, he got into an offensive pose, the Hibiki anger building up in him like a pressure cooker. Then he saw his hands and it was like steam escaping from a valve. Looking down, he saw two tiny bulges in his shirt that should _not_ have been there... "NOOOOOO!!!" The next few hours lost in the tumult of emotion that followed. He remembered only the need to run, a frantic compulsion to escape at all costs. There was a flash as he released his bioenergy to blast a path and then running and running and running... ******** 1) The number tended to double each time he told the story. 2) Which he would later find out was just as well. ******** "Later, Vilian found me again," Takeru continued, a quiver in his voice. "Cologne had released her. She explained about Jyusenkyou, and gave me one final curse that horrible old crone had seen fit to place on me." He looked up, eyes haunted by the newly-resurrected pain, and mistook Ryouga's awe-struck face as sympathy for his condition. "I've been looking for you ever since, so I could get advice on how to handle the problem," he finished. "Well," Ryouga said after a moment, "you've got to get back to Jyusenkyou and find the spring of drowned man. That will cure you." "I already thought of that," Takeru replied with a sigh, "but Cologne would just be there to stop me...if I could even find it." Ryouga looked like he was about to say something, but apparently thought better of it as Takeru continued, "But finding a cure isn't the problem anyway. I already have it." Ryouga fell over, his eyes grown to the size of saucers and his mouth dropped to his waist. He shot up and grabbed Takeru's collar. "YOU HAVE _WHAT_!?" "Calm down, bro!" Takeru put up his hand imploringly. "You didn't let me finish." Ryouga released his brother, though he still looked a little wild-eyed. "Cologne gave it to Vilian to give to me. It's a potion that will transform anything into a human male...but it will also drive them completely insane." "Nani?" "It destroys your reasoning and perception, causing you to become violent, impulsive and paranoid," Takeru explained, as he pulled a vial of glowing orange liquid from his coat. "And that's why I need your help. I have a cure, but it may be worse than the disease." Ryouga stared at the vial, fascinated by the faint glow. He reached over and took it from Takeru's grasp with the care he would have displayed if it was Akane's life he held. "Is there any wa "One, but it also nullifies the transformation." He stood up. "I'm not sure exactly what it is. All Cologne told Vilian was: it is a force that no army can defeat, no barrier can hold back and no person can outrun. It has toppled empires, and since the beginning of time, millions have died in its name. Yet we cannot live without it'." Ryouga shrugged, and put the vial down on the floor. "So you want me to tell you whether or not you should use this? I say don't. After all, you may be a girl half the time, but at least you're sane." "You don't understand." Takeru closed his eyes tightly. "I've lived with this curse for almost four, five years. I'm not sure how much longer I can stand it." "I don't know..." said Ryouga, "a year is a long time too..." "You don't understand!" Takeru repeated. "I was only ten or eleven when I got this damned curse! I went through puberty with a half-female body! Do you have any idea what that's _like_!?" "I...I..." Ryouga, of course, did not. "Damn that old hag for doing this to me!" Takeru jumped up and pressed his palm against the wall. A blue corona began to flicker along his body as tiny bolts of blue-white bioelectric force jumped along his arm and concentrated at his hand. "Damn her to HELL!!!" Ryouga covered his eyes as the corona flashed with sudden, blinding fury, accompanied by an explosion of noise like a hundred million hornets bursting from their nest in anger. Ryouga felt a cool breeze, and looked over to see a large, circular hole blown in the wall, with Takeru-chan's hand in the middle. Rain had come in and activated his curse; Ryouga kept a discreet distance. "Look at what I've become!" Takeru-chan said, her shoulders slumping. "I can't even control my own power..." she sobbed. "What good am I to anybody!?" She leaped out the hole and was gone. Ryouga's first impulse was to take off after her, but he knew his brother needed time alone, and Ryouga needed to think too...especially about how he was going to break the news to Takeru about a certain purple-haired amazon... With a grimace on his face he walked out. On the floor the potion glowed, forgotten... ******** BOOM!!! "What was that!?" Akane cried, stopping as she went up the stairs. "It sounded like an explosion," Ukyou offered, from where she stood at the base of the steps. "And it came from the bathroom," Ranma finished. "I've got a bad feeling about this..." They sprinted up to the bathroom, threw open the door and gaped at the hole leading outside, completely overlooking the vial on the floor. "Look's like Ryouga's handiwork," commented Ranma. "Hai..." Ukyou said, walking over, "but why would Ryouga do.." She touched her finger to the edge of the hole and then jerked it back with a cry of pain. It's all right," she said as the other two took a step forward. "I just got a shock." She rubbed her hand. "Now why would the wall be charged like that?" "Now that you mention it," Akane said, "That wasn't so much an explosion as it was a...crackle, like a high voltage line." "A lightning strike?" Ranma offered. "If that's what happened, then why didn't the debris fly _into_ the room?" Ukyou said, shaking her head. "I don't know," Ranma muttered, walking out, "but something's happening around here and I don't like it." "Wait for me, Ranchan," called Ukyou, following him outside. "'Wait for me, Ranchan'," Akane imitated in disgust. "Honestly, what does she see in him?" She started after them, then stopped as she noticed something glowing innocuously on the floor. "What's this?" She leaned down and picked it up, noticing the strange, almost alluring glow. After a moment she shook her head and rubbed her eyes with her free hand, then noticed a white strip on the other side. Turning it around, she read the message, which was in both Japanese and Chinese. "For best results, mix in well with solid foods..." She paused. "Oh, it must be some type of spice! Well, I can make a great meal with this, and show that bimbo Ukyou I can cook just as well as her any day!" She ran down to the kitchen, inspired by visions of her latest culinary masterpiece. ******** Ranma and Ukyou made their way into the dojo. "Why hello Ranma, Ukyou," Kasumi called from where she was sweeping. "Hi, Kasumi," said Ranma. "You haven't seen anybody around here, have you?" "No, I don't think so." Kasumi paused. "I wouldn't think anybody would be out on a night like this." "Well," Ranma said, "we need you back at the house. Something blew a hole in the bathroom." "Oh my. So that's what that sound was. I thought it was just lightning." "Wait," Ukyou frowned. She pointed at the window. "Look outside. That isn't even a thunderstorm." "You're right," Ranma agreed. "That means someone _did_ do it. But who?" ******** Ryouga wandered into the kitchen, his mind filled with thoughts of amazons and brothers and bears, oh my... "Hello, Ryouga-kun," Akane called sweetly, from her position by the stove. "A-akane!" Ryouga yelped. "What are you doing here?" "I live here, silly," she replied. "What are you looking for?" "Uh..." he tried to think. "I-I'm looking for my brother...he got lost..." "That's too bad," Akane said, meaning it. "And I was making supper tonight, too." "You were?" Ryouga walked over and looked at the contents of the pot, an unidentifiable collection of fish parts, rice and various deformed vegetables. "Looks...good..." he hesitated, then noticed a faint, almost imperceptible glow. On a sudden suspicion, he looked to the side, where a familiar vial was on the counter. He snatched it up. "You didn't use _this_, did you?" "Why not?" Akane frowned. "It's just flavouring." Ryouga was dumbfounded. "Anyway, I'm going to go give some to Ranma. I'm sure he'll like it, aren't you?" She headed towards the door. Ryouga started to open his mouth to warn her, but was too surprised to speak when a tiny piglet that resembled P-chan, save for the red skin, tiny horns and spade-tipped tail, appeared floating in front of him. {Let her feed it to that jerk Ranma,} it said. {Serves him right for all he's done to you!} The pig had a point...listen to him, he was saying an imaginary piglet had a point. Then another piglet appeared, this one with white skin, tiny wings and a golden halo. {Don't listen, Ryouga,} it urged. {You're better than this. Imagine what would happen to Ranma!} {Yeah, he'd go nuts,} the devil-pig replied, {and you could save Akane from him!} {But Ryouga,} the angel-pig added, {it isn't right. Besides, it isn't for you to decide; that's Takeru's potion.} {So what?} the devil-pig retorted. {He'd want you to use it this way!} {But what if AKANE ate some?} That decided it. Ryouga ran after Akane, determined to get back that food. ******** "...maybe this has something to do with that girl Akane met who disappeared," Ukyou was saying. "Or with that jerk Ryouga's brother," Ranma added. Ukyou looked surprised. "You met him?" "Hai," Ranma grumbled, "he interrupted me and P-chan there before I could teach him a lesson." "Oh Raaannnnmmmaaa!" Akane called as she walked into the room. "I know that tone of voice..." Ranma said in dread, then had his fears confirmed as he saw the bowl of faintly glowing glop in her hand. "AHH!!! Get it away!" "Are you referring to my cooking?" Akane said dangerously, all trace of her good mood melting away. "I ain't eating that!" Ranma barked. "I already spent enough time in the clinic this summer!" "YES YOU WILL!" Akane tackled Ranma to the ground and began to try and pry open his mouth so she could force-feed him some. "Mo my mon't!" Ranma shouted, while still trying to keep his mouth closed. "Akane," Ukyou said placatingly, "Why don't you put that down and I'll help you cook something else." "Be quiet," Akane growled. "I put something special in this batch!" "Oh yeah?" Ukyou said, laughing despite herself. "What was it? Stomach medicine?" That did it. Akane was just _totally_ fed up with this bimbo and her idiot of a fiancee. They hadn't even tried her cooking, and they were already making fun of it. Tears in her eyes, she whirled to confront Ukyou. "Oh shut up!" she yelled, cocking back the bowl. The door burst open suddenly and Ryouga was standing there. "Akane!" he roared, "Don't eat that..." Too late. Akane hurled the bowl into Ukyou's face. The chef took it full on, too surprised by the unexpected violence to dodge. "...food..." Ryouga finished lamely. Ukyou gurgled for a moment, then threw the bowl to the floor and coughed. "Quick!" Ranma cried. "Call an ambulance!" Akane buried her fist in his face while simultaneously giving Ukyou an apologetic look, her anger of a moment ago cooled somewhat. "I'm sorry, Ukyou," she said. "I don't know what came over me..." Ukyou had a shocked look on her face, and she began to shudder. I can't believe this! It actually tasted _good_!" She started to smile, but then her eyes widened and she gripped her stomach crying out in real pain. Sweat beads appeared on her forehead and she fell to her knees. "Ohhh, my head...what's happening..." "Oh no!" Ryouga shouted. "It's started!" "What's started?" Ranma looked up at Ukyou and gasped in surprise. Her body was...changing. Her legs thickened with muscle, straining against the hose she normally clad them in; her arms became bigger, her hands rougher, and her chest flatter. It only took a moment, and when it was over Ranma could have easily mistaken her for the same Ukyou he had first seen in Nerima. "U-ukyou..." ******** Takeru-chan sat on top of the Tendo Dojo, trying to regain her tenuous hold on her emotions. Already she could feel the calm flowing through his mind, but she wished she had something to occupy it. Combat was best. A good, adrenaline-pumping battle always helped her focus on reality, and not let her emotions carry her away. She regretted her sudden anger in the bathroom, and the subsequent outpouring of energy at the innocent wall. Looking at her hands, she wondered how she had done it, like she had done it against the Joketsuzoku tribe. Without her plunger to channel her bioelectric force, she had never succeeded in using it like that except when her emotional grasp slipped loose. She smiled bitterly. Imagine if she _were_ insane. Then her bioelectricity could probably start blowing up city blocks. A sudden scream caused her head to shoot up. It was a man's scream, one that seemed to sum up horror and pain that Takeru couldn't believe a human was really capable of feeling. She stood up and looked over toward the far part of the building that made up the house. "What's going on?" she wondered aloud, and then leaped off the roof purposefully, heading in the exact opposite direction from the one she had heard the scream coming from. ******** "Oh my," Kasumi said, the nearest she ever came to profound shock. Ranma, toppled over and with his eyes bulging, was much less in control. Akane was staring, her body stiff with shock, while Ryouga had a look of chagrin and self-disgust on as he rested the responsibility for this solely on his own shoulders. Ukyou stopped shaking, the pain of her masculine meta- morphosis subsiding. She...he looked up. "What's going on?" Ukyou said in a trembling baritone, than paused in shock at the sound of he...his voice. "M-my voice..." Ukyou-kun murmured, and then he looked down at his now-flat chest. "No..." "Ukyou..." Ranma began. "NOOOOOOO!!!!" Ukyou screamed, his voice so full of pain that even Kasumi pulled back slightly in surprise. Ukyou-kun leaped up, obviously intending to run out, newly-formed tears already running down his cheeks. Ryouga stepped between him and the door. "Ukyou!" he yelled desperately. "Listen to me!" "Leave me alone!" he cried, lashing out in anger. His fist flashed forward and connected with a strength the old Ukyou couldn't have hoped to match. The force of the blow- made up of new musculature, adrenaline and pure anger-was enough to send Ryouga staggering back into the wall. Ukyou-kun was out the door before either Ranma or Akane could react. "Ow..." Ryouga groaned, regaining his balance and rubbing the indent on his cheek. Ranma stood up and walked over to him, his eye narrowing. "What just happened?" he asked, a hint of menace in his voice. "I-I can explain..." Ryouga stammered, but Ranma would hear none of it. "I can't believe it!" he growled. "_You_ are behind this! It was one thing when you were trying to ruin my life, but what has Ukyou ever done to you!?" He stepped forward and flexed a fist in Ryouga's face. "Be ready, pig-boy, cause after I find Ucchan I'm coming back to pound some answers out of you!" He stormed out after Ukyou-kun, the look on his face-one Ryouga could have sworn he'd never seen before-made Ryouga forego trying to stop Ranma and explain. For some reason that look made Ryouga...nervous. "What _is_ going on, Ryouga-kun?" Akane asked, her voice filled with worry. "A-akane..." Ryouga gulped. "Well, it's sort of...you see..." He decided he couldn't hide the truth from her. Not from Akane. {Sorry, brother.} "Do you remember my brother, Takeru?" "Of course, but..." Ryouga silenced her with an upturned palm. "It all began long ago in the mountains of China..." ******** Ukyou was having trouble thinking straight; not inexplicable, considering his current situation. After all, hadn't his entire world just collapsed into ash? He felt the steady drum of water on his body and wondered absently if he was outside or in the shower. He clutched his new body, hoping beyond hope that the water would wash it away, like a bad dream dissolved in the morning's light. But it didn't go away, wouldn't go away. Ukyou gritted his teeth, vainly struggling against the madness that seemed to lurk like some midnight-clad ninja just beyond his sight, waiting for him to drop her guard so it could strike. Well at least Tsubasa wouldn't bother him any more, he thought, and almost laughed. Look at him! Here he was, facing the worst crisis of his life, and he was thinking about _Tsubasa_!? He was definitely losing it...wait, thinking about that freak caused an old memory to resurface, a memory of his first visit to Nerima... He didn't notice that he had started giggling, a childish little titter. Of course! It wasn't over, Ranma was half _girl_! He began to laugh, a hideous cackle devoid of all sanity that just felt so _good_. ******** "UKYOU!!!" Ranma-chan called, from where she stood on the roof of the Tendo Dojo. She could have sworn she had seen her...uh... _him_ jump up here. (1) Apparently his desperation and new muscles had given him more than enough speed to escape, without even leaving a trail. Damn it, she thought. What could Ryouga have hoped to gain from turning Ukyou into a...guy... No, that wasn't possible. Could Ryouga have actually been trying to cure him? But if he had something that could do that, why hadn't he used it himself? No, there had to be some horrible side effect that would have made Ranma's life a living hell. And now Ukyou had to be the one who would live with it...maybe forever. She blinked her eyes, absently brushing away some rain- water that had accumulated there...were those tears? Why was she so torn apart over what was happening to Ukyou? "Excuse me, miss," a voice called, interrupting Ranma-chan's musings. She turned to see a girl clad all in green and with platinum blonde hair standing on the edge of the roof. "What are you doing up here?" she asked the unnamed woman. "I'm not exactly sure," she replied in apparent confusion. "If you'll just point me towards the Tendo dojo, I'll be on my way..." "Why do you want to go there?" Ranma-chan inquired in sudden suspicion. "I left some...dangerous chemicals there with a...friend, and I have to collect..." "YOU gave Ryouga that stuff!" Ranma interrupted, and he could tell from the look of shocked recognition on her face that she knew something. "You did that to Ukyou! "Ukyou!" she breathed. "I never meant for her..." "So you _are_ behind it!" Ranma-chan took a few steps forward. "Well, nobody messes with my friends and gets away with it!" Ranma charged, managing to catch the woman off-guard and shoving her clear off the roof. The girl yelped, but recovered quickly by using a plunger to adhere to the wall. "Hey!" she growled. "I was going to help you! But if you want it this way then that's fine with me!" Ranma had only a moment to consider if she had acted rashly before she was drawn into a really knock-down drag out fight. The girl was better than she had expected; somehow managing to counter almost all of Ranma's moves and forcing her to keep her distance with that superlong plunger she wielded like a staff. Finally Ranma saw a weakness in her technique, and capitalised on it by forcing the girl to overswing in order to tag her. Despite the pain in her ribs where the plunger had connected, she still managed to clasp the shaft and pull the girl off her feet. Ranma yanked her forward and smashed her elbow into her face, but she counterattacked with a powerful leg sweep into Ranma's groin that picked her up and sent her flying. (2) The girl took up a defensive stance, still somewhat groggy from the elbow smash, while Ranma-chan landed with relative ease and rushed forward, her fist cocked back in preparation to finish this quickly. "KACHUU TENSHIN AMAGURIKEN!!!" she cried. Speed flowed into her arms and she sent her fists flying forward in a whirlwind of blows which struck the stranger and sent her staggering backward. Ranma finished the manoeuvre with a final sizzling uppercut that caused the girl to fall to her knees, using one hand to steady herself. Ranma felt a brief surge of self-loathing at her violent treatment of this girl but shook the feeling away; anyone who would do what she had done to Ukyou wasn't even human, much less a girl. Gritting her teeth, she launched herself skyward in pre- paration for an elbow drop. The girl looked up as Ranma-chan began her descent. "No," she said in a small voice, clenching her free hand. "You won't win that easily!" Somehow she managed to leap towards Ranma-chan with a powerful rising uppercut, but Ranma could have avoided that. She couldn't avoid what came next. "KAMIRAISHOKEN!!!" As Ranma watched a pillar of blue-white lightning streaked from the sky, connecting her upraised fist, the ground and the sky so suddenly that it appeared like it had no origin. Ranma, unfortunately, was caught in the pillar and sent flying, flashfried, over the edge of the roof. She felt her head hit something hard, and then everything went black... What Ranma didn't see was Takeru-chan finishing her supermanouevre, the perfect version of her bioelectric power. She was still coated with arcs of electricity as the aftereffects of channelling so much power when she hit the rain-coated roof. And anybody who passed fourth grade science could tell you that water and electricity don't mix... ******** 1) Geez, the pronouns are getting confusing in this story! 2) All through the flight, Ranma gave silent thanks for his current feminine physiology. ******** Ryouga finished the story and stood back, ready for whatever punishment Akane saw fit to dish out. He was surprised when she didn't pound him, and merely sat with a look of shock and surprise. (1) "Wow," she said simply. "That's some story." Ryouga blinked. "But didn't you hear me..." he began. "I heard you," Akane cut in, "and all about how you _almost_ decided to let Ranma eat that stuff." She shook her head. "But you didn't, Ryouga-kun; you wouldn't have done that to him. Mousse might have, but you can't blame yourself." "Oh, Akane-san." Ryouga took one of her hands in his, eliciting a small widening of her eyes. "You're so forgiving. But I can't avoid the responsibility for Ukyou's condition." A hint of self-loathing entered his voice. "If I hadn't hesitated because of my hate for Ranma...if I hadn't let it control me, even momentarily..." "Ryouga..." Akane began, then pulled her hand away in shock as a deafening crackle of power roared from somewhere above. "What was that!?" "It sounded like Takeru's bioelectric power," Ryouga cried, jumping to his feet. "And it came from the roof!" He ran over to the sliding patio door and threw it open just in time to see Takeru-chan tumble off the roof, her body singed, and land in a heap nearly ten feet from the door. Ryouga took a half-step forward, then stopped his foot less than an inch from the exterior downpour. His eyes widened and he looked back involuntarily at Akane, who was watching him expectantly. "Aren't you going to help her?" she asked? Ryouga reached for his umbrella, and cursed himself when he remembered it now rested outside. He looked between Akane and Takeru, torn between two choices, both terrible. Do what he could to help his brother, and reveal the horrible truth to Akane? Or protect his secret at the cost of his brother, and perhaps lose Akane's respect in the process? Whomever coined the word 'dilemma' must have foreseen this moment. {What do I do!?} Ryouga screamed silently. ******** 1) Of course, the fact he hadn't mentioned his own curse or the _real_ reason he had finally decided not to let Ranma eat that stuff probably had something to do with his continued well-being- such as it was. ******** When Ranma woke up it was dark. She shook her head, wondering how long it had been since she'd lost consciousness. She was on something soft and dry, but her clothes were still wet. It was very dark, almost pitch, but strangely it wasn't raining. She put two and two together and decided she was inside on a futon and that it wasn't long after her recent battle. She tried to sit up, but found she was still in too much pain from the shock to her nerves by that girl's technique. She grudgingly admitted the stranger could pack a wallop, but Ranma would work harder next time, now that she had a score to settle Taking a deep breath, she carefully pushed herself into a sitting position. The lights came on so quickly that her eyes didn't have time to adjust. "You're awake," a semi-familiar man's voice said from the blur. "Dr. Tofu?" Ranma-chan guessed. Well, she was still a woman. "Not exactly," the voice responded with a titter. Ranma's eyes finished adjusting, and she gasped. There stood Ukyou-kun near a mirror, with lipstick smeared all over his lips and chin in a red circle. His eyes had green eyeshadow inexpertly applied, and there were red glops of blush on his cheeks. He was still wearing the tight-almost bursting-okonomiyaki chef's outfit, and was smiling in a way that made Ranma feel _very_ nervous. "Ukyou!" Ranma gasped, realizing now the hard object he had hit was her spatula. "Guilty!" Ukyou-kun giggled. "And how are you, Ranchan?" "F-fine..." Ranma-chan said, unable to hide her nervousness. The look in those eyes was _not_ the look of the Ukyou he knew and... "What d'ya think?" He interrupted Ranma's train of thought as he gestured at the grotesque mess of his face. "Pretty, isn't it?" "Well...uhh..." He came forward and pinned Ranma-chan's arms against the wall. A brief glance of a familiar photo showed that he was in Akane's room. Ukyou smiled that unsettling smile again. "Isn't this great, Ranchan?" he said excitedly. "It's perfect; I'm a guy now and you're a girl now..." Ranma couldn't believe her ears. Was Ukyou implying what she _thought_ he was implying... "Ukyou!" Ranma broke past his nervousness. "W-we can't! I mean, you're a g-guy now and I'm not sure I felt that way even..." "It's _her_, isn't it?" Ukyou's voice dripped with malice and her face became a rage-filled mask. "It's that _bitch_ Akane!" "NO!" Ranma replied quickly. "But Ucchan, we have to cure you..." "Cure? CURE!?" he screeched, lifting her from the futon like a rag doll. "I don't need a cure, I need you!" "Ukyou, you're sick," Ranma pleaded. "We have to get you to someone who can help!" "So _that's_ what you think," he hissed. "You think I'm sick! Well, I'll show you sick!" Ukyou-kun drove a knee into her stomach, and followed it up by tossing her over his shoulder into the wall. Ranma was still too groggy to attempt to control her flight, but Ukyou-kun didn't even give her that chance as she swung around with a powerful pivot kick that caught her in the ribs-the same spot the stranger had earlier. She heard a bone-shattering crack and felt white-hot pain flooding through her. Crashing into the wall, she slumped to the floor, barely clinging to consciousness. "You don't want me?" Ukyou-kun sneered as he came over to her, spatula held in his hands. "Then I don't need _you_!" Ranma-chan couldn't have protected herself if she tried, as it was all she could do to watch as he reversed the weapon, pointing the long, sharp edge at her. "Sorry you made me do this," she said in mock sympathy, and then sent the blade sailing at her... ******** Akane wondered why Ryouga was hesitating. She was sure that was Takeru, Ryouga's brother, outside, but he wasn't rushing out to save him. Then she noticed the downpour and remembered Ryouga's acute hydrophobia. It always acted up when he was around water that ran uncontrolled; lakes, rivers, fountains, sprinklers and so on. Probably the biggest reason he used an umbrella as a weapon. Funny how he never mentioned it... "Akane!" Ryouga cried, in sudden excitement. "Quickly, call Dr. Tofu and tell him to come over! We may need him, and to help with Ukyou too!" "Right," Akane said, and ran into the kitchen to get to the phone. She pulled it of the cradle and began to rapidly punch the numbers. She almost screamed when the spatula cleaved the cord in two. She stared at it, and the blood along its edge, and then she did scream, but a hand fell over her mouth and muffled it. "Shhh," whispered Ukyou-kun with a giggle. "We don't want Ryouga to hear." Akane's eyes widened as she looked into Ukyou- kun's face and saw no hint of sanity. ******** Ryouga couldn't help but feel a touch of pride at his brilliant plan. (1) He rushed over to the table and hefted it with ease. Walking out the door, he put his makeshift umbrella over his head, vaguely hoping Akane wouldn't walk back in, as this might be a little hard to explain. He ran over to his brother, avoiding puddles with an unconscious ease gained through almost a year of practice, and stopped only long enough to scoop Takeru-chan up with one arm before running back in the house. Then he placed Takeru on the floor and put the table back. For a brief moment he felt a glow of pride at his accomplishment, then he started to wonder why Akane wasn't back yet... "Oooooh..." his brother groaned, and Ryouga walked over to her. Takeru-chan blinked her eyes open. "Ryouga?" "Hey, bro," Ryouga said with relief. "You looked pretty bad there for awhile." "Man," she rubbed her chin, grimacing. "This little bitch attacked me up on the roof." "Huh?" Ryouga blinked. "Some redhead jumped me for no reason and accused me of using that potion on Ukyou." She paused thoughtfully. "She sure could move fast..." "Red-haired girl?" Ryouga said hesitantly. "She didn't have a pig-tail, did she?" "Actually, now that you mention it, she did. Do you know her?" "Hai," Ryouga grinned, "And so do you." "Nani?" said Takeru, frowning. "That was Ranma." Takeru gaped, and Ryouga continued, "You see, he also ended up at Jyusen..." "RYOUGA! HELP ME!" "_AKANE_!!!" Instantly, Ryouga was up and heading for the kitchen. Akane's cry had been one of sheer panic and animal fear. Only one thing Ryouga could think of could provoke that... ******** 1) Well, maybe not _brilliant_, but Ryouga has ideas of this calibre so rarely he can't really be blamed for exaggerating this one. ******** Ranma-chan was in pain, but that wasn't about to stop her. Using her good hand, she held onto the shoulder Ukyou-kun had shattered with his spatula. She took a step towards the door, forcing herself with deeply ingrained breathing exercises and concentration to ignore the pain and weakness due to blood loss. She wondered why Ukyou hadn't gone through with his threat, merely disabling her arm instead of lopping of her head, and then pushed it out of her mind. Ukyou-kun was dangerous, out of control, and had to be stopped. Just how exactly she planned to do that in her current condition was something Ranma avoided thinking about. But before she could do that, she had to find him. She stopped long enough to open the door; in the brief time she took her hand off her wound, she felt a fresh trickle of warmth seep out. Then she was outside and able to replace her makeshift bandage. She headed towards the stairs... "RYOUGA! HELP ME!" "Akane..." Ranma-chan breathed, and instantly knew what was happening. Injuries ignored as much as possible, she headed at top speed for the kitchen... ******** Akane was scared, and after being kidnapped more times than Princess Toadstool, threatened by perverts, psychos and idiots, and almost married so many times she'd lost count, it took some- thing _big_ to scare her. Like zombies, ghosts, or an insane male version of a friend...sort-of friend. Listen to her. Here Ukyou was with a blood stained spatula and the look of a crazed psychopath on her face, and Akane was debating on whether she was a friend or not! With his superior strength, Ukyou-kun pushed Akane back against the wall, still with a hand over her mouth. "You're the problem," he hissed. "You caused it all. First you do...this..." He indicated himself, trembling with anger. "Then you take away my Ranchan. You're like a tumour, and tumours should be removed." Akane's eyes widened, and Ukyou suddenly smiled. "But Ranma doesn't really matter much anymore..." he said, displaying the bloody spatula edge. "I took care of him." Ranma...Akane went _cold_. No, it wasn't true! Ukyou-kun was smiling, _smiling_! How could he be smiling after...after... Rage boiled up in her, overwhelming her fear like a tsunami absorbed smaller waves. She knew she wouldn't have much time, so she had to hope Ryouga hadn't gone far. She bit into her captor's hand with all the force she could muster, and when Ukyou- kun reflexively drew back, Akane sent a forward kick into his chest. Ukyou stumbled back, and Akane drew in her breath... "RYOUGA! HELP ME!" she screamed at the top of her lungs, more fear in her voice than she really wanted. Approximately three nanoseconds later the door exploded into a million pieces as Ryouga charged in like a bull. "GET AWAY FROM HER!" he roared, and came in at Ukyou with a powerful haymaker. Ukyou-kun responded by seizing the arm with his free hand and using an Aikido technique to send him flying into the far wall. Ukyou ran at him with his spatula, but Ryouga was already on his feet and walked in under his swing to land an uppercut on his chin. Ukyou-kun reacted with a ear-piercing shriek and an elbow to the shoulder. Ryouga gasped in pain and was forced down as Ukyou's blow reignited the earlier injury. Ukyou-kun capitalized on it with a haymaker to Ryouga's cheek and a powerful blow with the side of the spatula that spun him like a top and to the ground. "NO!" a voice roared, and the long shaft of Takeru's plunger slammed into the back of Ukyou's head, followed shortly by the boy- turned-girl who had thrown it. Ukyou-kun was thrown off-balance and Takeru-chan managed to land a powerful pivot kick on his side. But Ukyou was driven by magically-induced madness, and pain didn't faze him. He grasped Takeru's foot and sent her flying like a rag doll, then instinctively sent his spatula so that she slammed into it, then flipped her like an okonomiyaki and pounded her into the ground with all his might. Takeru-chan groaned, barely clinging to consciousness. Ukyou-kun then proceeded to turn on Akane like a viper, his eyes blazing with hatred. "Now, Akane!!!" She watched numbly as Ukyou sent the spatula flashing in a deadly arc at Akane...but at the last moment a yellow blur sent her flying out of the way, and she heard a sickening sound like a melon being chopped. Landing on her side, she looked back to see Ryouga falling to his knees, hand pressed against his neck in a desperate attempt to stop the red liquid gushing between his fingers. Ukyou-kun stood over him, his eyes wide and his fingers only loosely holding the spatula. {He saved my life...} Akane thought... "MOKO TAKABISHA!!!" Akane gasped as a beam of pure yellow energy crashed into Ukyou-kun with the force of a freight train and sent him flying into the wall. She looked over to see Ranma-chan on her hands and knees, a terrible-looking gash in her shoulder and a look of exhaustion on her face. "Why..." she gasped, "...her..." "Ranma!" Akane cried, hot tears running down her cheeks. "I thought you were dead!" "Not getting...rid of me...that easy...tomboy..." Forcing herself to her feet, she staggered over to Ukyou-kun, who was regaining consciousness. "I...can't fight...anymore..." She fell to her knees in front of Ukyou, whose eyes snapped open like shutters. "Ranchan..." he said, in a vaguely distorted voice. "That's it!" Takeru-chan propped herself up on his arms, having figured out the truth about Ranma's curse when Akane had called her by name. But more importantly... "The cure! The thing that has toppled empires and that no army can beat, it's _love_!" "Nani?" Akane said in confusion. "The potion forces insanity on the person," Takeru explained breathlessly, "but the person still in there, struggling. All she needs is the additional strength to overcome the potion. Strength only her..." she grimaced, "love for Ranma can give her." Ukyou-kun reached up to clutch Ranma-chan's shoulder, eliciting a cry of pain. She looked down into those still-familiar sea-blue eyes, and suddenly she _knew_. She knew why this whole thing has upset her so much, and why she felt Ukyou's pain like it was her own. Ranma had never been able to bring himself to love Ukyou the way she loved him; he had always thought of her as just his best friend. But she was _more_ than his friend... she was his only real companion, someone who could listen to his problems without always getting mad or taking advantage of them, a solid rock in a life filled with turmoil and confusion, that he could put his back to for protection or lean against for support. She was one of the most important people in his life, and now that she needed _his_ help, Ranma would do whatever it took to save her. "Ukyou...UCCHAN!" Ranma said through the pain. "I know you're in there! If you weren't, you wouldn't have spared my life! Come back to us, Ucchan...to me..." She reached out with both hands and clutched his face between them. "Do it for me..." she breathed, leaning down... Akane couldn't help but watch, like one of those horror movies where you know the person's head will be lopped off when they open the door, but can't look away. Her heart was twisted in so many directions, torn by pity, jealousy, sorrow and other feelings she couldn't even name as she watched, in stunned fascination, Ranma gently kiss Ukyou's forehead. A strange pink aura seemed to cover them both, and then a white flash filled the room as the vile potion was burned up by a force it couldn't hope to overcome. And when the light cleared, Ranma-chan was holding the trembling and crying form of Ukyou, once more a girl, and murmuring a soothing chorus of "It's all over now, it's all over now..." "There are other people in this house too, you kn..." Nabiki was saying as she walked into the room. But the hint of annoyance drained out of her face and voice as she took in the situation. "Quick oneesan," Akane burst out, "call an ambulance..." "Uh-huh," she said, for once without quip or sarcasm. "Right on it." ******** Ranma lay in his hospital bed, reflecting on the incident of that night almost two days ago. He was glad Ryouga was doing okay; it had turned out the wound wasn't that deep, and the quick reaction of the ambulance-along with Dr. Tofu, whom Nabiki had also called-had saved his life. Ranma had been told he had re- gained consciousness this morning, but wouldn't be permitted visitors until tomorrow. Ranma, meanwhile, could receive them today. The first to enter was Ukyou; she thanked him exuberantly, and if one was to judge from her demeanour she was well on her way to recovery. She seemed like the old Ukyou again, full of optimism and verve. Ranma wished he could heal as fast, but every time things like this happened the mental wounds went deeper, the emotional scars were bigger and lasted longer. Next in was Akane. She and Ukyou seemed nervous with each other, but there was something there that wasn't before, something in Akane's general attitude towards Ukyou. It was almost... accepting, if not exactly friendly. The third was Takeru, who offered his deepest apologies to everyone concerned. Ranma had learned, from a note Akane had sent him, all about his curse and his story. He wasn't ready to be anywhere near decent to the boy-actually, he wished he'd leave shortly-but didn't blame him and said as much. Next in were Soun and Genma. Soun alternated between tears of joy at Ranma's recovery and yelling at the boy for wrecking his house...again. Genma ate Ranma's jell-o that he had been saving for later and absently patted him on the head. Then some one entered, whose appearance Ranma had been dreading ever since Takeru had arrived... "Aiya! Shampoo bring medicine, Ran..." "YOU!" Takeru roared, beginning to crackle with arcs of lightning. ******** The man walking outside was surprised when a fourth-floor window of the hospital was blown out by a giant flash of blue- white lightning, and he blinked as he heard the clearly-audible shouts from it. "Aiya!" "Come back here, you..." "Ranma! Who invited Shampoo!?" "Explain yourself, son!" "Anybody got some food?" "Why me? Why ME!?" The man continued on his way with a shrug. Just another one of those things in Nerima he didn't understand. Fin Blade: Well, thus ends Ukyou: Affairs of The Heart, Book 2. And let me tell you, that took a _while_ to write. Epsilon: Type, you mean. Blade: (WHAM) Shut up! I wrote some of it too, and I played the original RPG with you! Epsilon: Not that it's much the same. I mean, the original RPG wasn't even in this _series_! Blade: So? It wasn't this dark, either. Epsilon: That's cause I cut out the Glowing Blue Orb with the Mysterious Writing and the Feathers Sticking Out sequence. Blade: Good. It didn't exactly fit with the tone of the story, and it would have been a pain to type all those "Glowing Blue etc." Epsilon: Besides, you used it on the GRIT anyway. Blade: I know. ^_^ Ain't I a genius? Epsilon: Do you want an honest answer? Blade: Oh, shut up. Anyway, tune in next book...when Ranma DIES!!! BWAHAHAHAHAHAHAHAHAHA!!! Epsilon: You wish. Blade: Yeah, I do. I just saw that cute little scene with Ranma and Ucchan in the Shampoo's Jewel OAV again. I'd like to rip out fem-boy's guts and strangle him with them... Epsilon: (rolls his eyes) Right. Anyway, tune in next installment for something a _lot_ more light-hearted... Blade: Not that it could miss... Epsilon: ...when we explore the wonders of domestic life with every- one's favourite tomboy. Ranma doesn't die, of course... Blade: But he may wish he had! BWAHAHAHAHAHAHAHAHA!!! Epsilon: ...but he may wish he..hey! (glares at Blade) That was my line! Blade: *BEEDA* Epsilon: Anyway, be sure to check out our next installment in this series... Blade: Drumroll, please... Epsilon: "Life... Blade: ...with Akane!" Blade and Epsilon(singing): "Love and mallets, Love and mallets, Go together Like a toxic salad..." Handy Special Move Guide: Dentenha: Lightning wave; ie Shock Wave Kamiraishoken: Heavenly Thunder Ascension